Hopp til innhold

Øvelse

Aktivitet: Utforsk genteknologi med saks og lim

I genteknologi bruker vi mikroorganismer og proteiner til å klippe og lime sammen biter av DNA. I denne aktiviteten skal du prøve å overføre et humant gen til en bakterie ved bruk av illustrert genteknologi.

LK20
Genredigering. Konseptuell illustrasjon av en saks som klipper i DNA.

Bakgrunnsteori

Restriksjonsenzymer er enzymer som fungerer som molekylære «sakser» og kan klippe ut deler av DNA ved at de gjenkjenner helt spesifikke basesekvenser. Dette er et nyttig verktøy hvis du ønsker å sette sammen DNA fra ulike organismer. For at de ulike DNA-bitene skal feste seg til hverandre, bruker man enzymet ligase. Det danner bindinger mellom de ulike basene og «limer» dermed bitene sammen.

Til å kunne overføre biter av DNA fra en organisme til en annen bruker man ofte plasmider. Plasmider er sirkulære DNA-molekyler som er isolert fra bakterier og inneholder bare noen få gener. Hvis man setter inn ønskede DNA-biter i et plasmid i en bakterie, vil disse DNA-bitene bli kopiert hver gang bakterien formerer seg.

Til å sjekke om genredigeringen er vellykket, bruker man seleksjonsmarkører. En seleksjonsmarkør kan for eksempel være et gen som gir bakterien antibiotikaresistens, eller et gen som gir bakterien fluorescens. På den måten kan du velge ut og dyrke fram bare de bakteriene som viser vellykket genredigering.

Prosessen fra spyttprøve til seleksjon av vellykket framstilling. Illustrasjon.

Genet som koder for ønsket egenskap, identifiseres i isolert DNA fra en spyttprøve. Restriksjonsenzymet binder seg til restriksjonssetet og klipper ut genet som koder for ønsket egenskap. Isolert plasmid fra en bakterie klippes med samme restriksjonsenzym, slik at de ulike DNA-fragmentene passer sammen. Til å binde DNA-fragmentene fra de to ulike organismene sammen bruker man enzymet ligase. Resultatet blir et rekombinant DNA-molekyl som settes inn i bakterien for å bli kopiert opp. Ved hjelp av seleksjonsmarkøren vil det være mulig å identifisere bakterier som inneholder det rekombinante DNA-molekylet, og på den måten dyrke fram bare disse bakteriene.

Utstyr og forberedelse – lærer
  • saks merket «restriksjonsenzym»
  • lim eller teiprull merket «enzymet ligase»
  • fargestifter
  • utskrevne papirmaler (se vedlagt PDF nederst på siden)

Maler til merking av saks og lim eller teiprull ligger i den vedlagte PDF-filen sammen med papirmaler for isolert DNA fra spyttprøve og plasmid. Det kan være en fordel at DNA-sekvensen som illustrerer plasmidet, allerede er klippet ut og formet som en ring.

Oppdrag

Du skal overføre et humant gen til en bakterie, som igjen skal masseprodusere det proteinet det humane genet koder for.

Framgangsmåte

Nå skal du få øve på kutting og liming av DNA. Vi bruker papirstrimler som modell for DNA, saks som restriksjonsenzym og lim eller teip som enzymet ligase.

Verktøy i arbeid med DNA

  • humant DNA fra spyttprøve (lineært DNA)
  • gen som koder for ønsket egenskap (lineært DNA)
  • plasmid (sirkulært DNA)
  • restriksjonsenzymer
  • enzymet ligase
  • seleksjonsmarkør
  1. For å kunne jobbe med genteknologi trenger du isolert DNA. Dette har du fått utdelt på et eget ark. Det første du må gjøre, er å identifisere genet som koder for en ønsket egenskap, i den isolerte DNA-prøven. Baserekkefølgen til genet er angitt i tekstboksen under. Bruk fargestifter til å markere genet i DNA-prøven. Obs! Det er bare baserekkefølgen til den ene tråden av genet som er oppgitt.

    Gen som koder for ønsket egenskap:

    AATTCCGACGTTACGTTAATGCTAGAGGCTGCG

  2. Når du har identifisert genet som koder for den ønskede egenskapen, må du velge et restriksjonsenzym som kan brukes til å klippe DNA-tråden. Velg restriksjonsenzymet som passer til å klippe ut genet ditt, fra figuren under.
    Restriksjonssete og klippemønster for tre ulike restriksjonsenzymer. Illustrasjon.

    Restriksjonssete med stiplet linje som illustrerer klippemønster for tre ulike restriksjonsenzymer.

  3. Marker alle restriksjonssetene for det valgte restriksjonsenzymet med en ny fargestift. Obs! Det er viktig at restriksjonsenzymet du har valgt, ikke kutter i genet du ønsker å jobbe videre med.
  4. For at genet som koder for ønsket egenskap, skal kunne settes inn i bakteriens plasmid, må plasmidet kuttes med samme restriksjonsenzym som du valgte for å klippe ut genet, slik at endene passer sammen. Marker alle restriksjonssetene for det valgte restriksjonsenzymet i plasmidet med en fargestift.
  5. Nå er det på tide å la restriksjonsenzymene gjøre jobben sin. Husk at restriksjonsenzymene klipper i bestemte mønstre.
  6. Overfør genet som koder for ønsket egenskap, til plasmidet. Passer bitene sammen? Bruk enzymet ligase til å lime bitene sammen.
  7. Genet som koder for ønsket egenskap, inneholder en seleksjonsmarkør. Sjekk om genmodifiseringen ble vellykket, ved å identifisere seleksjonsmarkøren i genet du har satt inn i plasmidet. Bruk gjerne en fargestift til å markere seleksjonsmarkøren.

    Seleksjonsmarkør:

    TGCAATT

  8. Gratulerer med vellykket framstilling av rekombinant DNA og bruk av illustrert genteknologi. For at proteinet det humane genet koder for, skal kunne masseproduseres, må plasmidet settes inn i en bakterie som dyrkes videre under optimale forhold. Bruk kreativiteten din for å illustrere dette.

Filer

Denne siden er en bearbeidet utgave av Modellforsøk – rekombinant DNA fra Bioteknologirådet.

Sist oppdatert 18.03.2022
Skrevet av Guttorm Iversen og Camilla Øvstebø
Rettighetshaver: Bioteknologirådet

Læringsressurser

Bioteknologi i praksis

Hva er kjernestoff og tilleggsstoff?