Hopp til innhald
TasksAndActivitiesOppgaver og aktiviteter

Øving

Aktivitet: Utforsk genteknologi med saks og lim

I genteknologi bruker vi mikroorganismar og protein til å klippe og lime saman bitar av DNA. I denne aktiviteten skal du prøve å overføre eit humant gen til ein bakterie ved bruk av illustrert genteknologi.

FooterHeaderIconFooter iconLK20
Genredigering. Konseptuell illustrasjon av ei saks som klipper i DNA.

Bakgrunnsteori

Restriksjonsenzym er enzym som fungerer som molekylære «sakser» og kan klippe ut delar av DNA ved at dei kjenner igjen heilt spesifikke basesekvensar. Dette er eit nyttig verktøy viss du ønskjer å setje saman DNA frå ulike organismar. For at dei ulike DNA-bitane skal feste seg til kvarandre, bruker ein enzymet ligase. Det dannar bindingar mellom dei ulike basane og «limer» dermed bitane saman.

Til å kunne overføre bitar av DNA frå ein organisme til ein annan bruker ein ofte plasmid. Plasmid er sirkulære DNA-molekyl som er isolerte frå bakteriar og inneheld berre nokre få gen. Viss ein set inn ønskte DNA-bitar i eit plasmid i ein bakterie, vil desse DNA-bitane bli kopierte kvar gong bakterien formeirar seg.

Til å sjekke om genredigeringa er vellykka, bruker ein seleksjonsmarkørar. Ein seleksjonsmarkør kan til dømes vere eit gen som gir bakterien antibiotikaresistens, eller eit gen som gir bakterien fluorescens. På den måten kan du velje ut og dyrke fram berre dei bakteriane som viser vellykka genredigering.

Prosessen frå spyttprøve til seleksjon av vellykka framstilling. Illustrasjon.

Genet som kodar for ønskt eigenskap, blir identifisert i isolert DNA frå ei spyttprøve. Restriksjonsenzymet bind seg til restriksjonssetet og klipper ut genet som kodar for ønskt eigenskap. Isolert plasmid frå ein bakterie blir klipt med same restriksjonsenzym, slik at dei ulike DNA-fragmenta passar saman. Til å binde DNA-fragmenta frå dei to ulike organismane saman bruker ein enzymet ligase. Resultatet blir eit rekombinant DNA-molekyl som blir sett inn i bakterien for å bli kopiert opp. Ved hjelp av seleksjonsmarkøren vil det vere mogleg å identifisere bakteriar som inneheld det rekombinante DNA-molekylet, og på den måten dyrke fram berre desse bakteriane.

Utstyr og førebuing – lærar
  • saks merkt «restriksjonsenzym»
  • lim eller teiprull merkt «enzymet ligase»
  • fargestiftar
  • utskrivne papirmalar (sjå vedlagd PDF nedst på sida)

Malar til merking av saks og lim eller teiprull ligg i den vedlagde PDF-fila saman med papirmalar for isolert DNA frå spyttprøve og plasmid. Det kan vere ein fordel at DNA-sekvensen som illustrerer plasmidet, allereie er klipt ut og forma som ein ring.

Oppdrag

Du skal overføre eit humant gen til ein bakterie, som igjen skal masseprodusere det proteinet det humane genet kodar for.

Framgangsmåte

No skal du få øve på kutting og liming av DNA. Vi bruker papirstrimlar som modell for DNA, saks som restriksjonsenzym og lim eller teip som enzymet ligase.

Verktøy i arbeid med DNA

  • humant DNA frå spyttprøve (lineært DNA)
  • gen som kodar for ønskt eigenskap (lineært DNA)
  • plasmid (sirkulært DNA)
  • restriksjonsenzym
  • enzymet ligase
  • seleksjonsmarkør
  1. For å kunne jobbe med genteknologi treng du isolert DNA. Dette har du fått utdelt på eit eige ark. Det første du må gjere, er å identifisere genet som kodar for ein ønskt eigenskap, i den isolerte DNA-prøva. Baserekkjefølgja til genet er angitt i tekstboksen under. Bruk fargestiftar til å markere genet i DNA-prøva. Obs! Det er berre baserekkjefølgja til den eine tråden av genet som er oppgitt.

    Gen som kodar for ønskt eigenskap:

    AATTCCGACGTTACGTTAATGCTAGAGGCTGC

  2. Når du har identifisert genet som kodar for den ønskte eigenskapen, må du velje eit restriksjonsenzym som kan brukast til å klippe DNA-tråden. Vel restriksjonsenzymet som passar til å klippe ut genet ditt, frå figuren under.

    Restriksjonssete og klippemønster for tre ulike restriksjonsenzym. Illustrasjon.

    Restriksjonssete med stipla linje som illustrerer klippemønster for tre ulike restriksjonsenzym.

  3. Marker alle restriksjonsseta for det valde restriksjonsenzymet med ein ny fargestift. Obs! Det er viktig at restriksjonsenzymet du har valt, ikkje kuttar i genet du ønskjer å jobbe vidare med.
  4. For at genet som kodar for ønskt eigenskap, skal kunne setjast inn i plasmidet frå bakterien, må plasmidet kuttast med same restriksjonsenzym som du valde for å klippe ut genet, slik at endane passar saman. Marker alle restriksjonsseta for det valde restriksjonsenzymet i plasmidet med ein fargestift.
  5. No er det på tide å late restriksjonsenzyma gjere jobben sin. Hugs at restriksjonsenzyma klipper i bestemte mønster.
  6. Overfør genet som kodar for ønskt eigenskap, til plasmidet. Passar bitane saman? Bruk enzymet ligase til å lime bitane saman.
  7. Genet som kodar for ønskt eigenskap, inneheld ein seleksjonsmarkør. Sjekk om genmodifiseringa blei vellykka, ved å identifisere seleksjonsmarkøren i genet du har sett inn i plasmidet. Bruk gjerne ein fargestift til å markere seleksjonsmarkøren.

    Seleksjonsmarkør:

    TGCAATT

  8. Gratulerer med vellykka framstilling av rekombinant DNA og bruk av illustrert genteknologi. For at proteinet det humane genet kodar for, skal kunne masseproduserast, må plasmidet setjast inn i ein bakterie som blir dyrka vidare under optimale forhold. Bruk kreativiteten din for å illustrere dette.

Filer

Denne sida er ei omarbeidd utgåve av Modellforsøk – rekombinant DNA frå Bioteknologirådet.

Sist oppdatert 04.12.2020
Tekst: Guttorm Iversen og Camilla Øvstebø (CC BY-SA)
Rettshavar: Bioteknologirådet

Læringsressursar

Bioteknologi i praksis

Kva er kjernestoff og tilleggsstoff?

Fagstoff

Oppgåver og aktivitetar